ARCHIVES
VOL. 4, ISSUE 4 (2019)
Characteristics of the cytochrome oxidase c subunit 1 gene, cockroaches from the hospital
Authors
Maxi Rein Rondonuwu, Max Tulung, Jimmy Posangi, Christina L Salaki, Mokosuli Yermia Semuel
Abstract
Cockroaches are members of insects that are most easily found in residential areas. Geographic isolation has given rise to new species of Cockroaches in various continents. Cockroaches have the potential to transmit more than 64 pathogenic microbes to humans. Research has been carried out which aims to obtain the position of species and the genetic characteristics of Cockroaches based on the cytochrome oxidase c subunit 1 (CO1) gene. Cockroach samples were obtained from the government general hospital Prof. dr. Kandouw, Manado, North Sulawesi, Indonesia. Genomic DNA extraction uses tissue in cockroach legs. Amplification of the CO1 gene uses universal primer forward LCO 1490 gene: 5 'GGTCAACAAATCATAAAGATATGG3' and Reverse HCO 2198: 5'TAAACTTCAGGGTGACCAAAAAATCA3', carried out by PCR and vizualization of amplicons using 0.8% agarose electrophoresis. Sequencing has carried out at Singapore's First BASE Laboratory. Based on the results of BLAST and the construction of cockroach CO1 gene phylogeny, it has the closest resemblance to Periplaneta americana. The sample MRKE sequence has mutated at 14 nucleotide sites and has a genetic distance of 2.7% with five other sequences. The other five sequences do not have different genetic distances and nucleotide sites.
Download
Pages:36-47
How to cite this article:
Maxi Rein Rondonuwu, Max Tulung, Jimmy Posangi, Christina L Salaki, Mokosuli Yermia Semuel "Characteristics of the cytochrome oxidase c subunit 1 gene, cockroaches from the hospital". International Journal of Entomology Research, Vol 4, Issue 4, 2019, Pages 36-47
Download Author Certificate
Please enter the email address corresponding to this article submission to download your certificate.

